circRNA_010567
 Genen/aOrganismMouse
 Genome Locuschr13:n/a-n/a:+Buildn/a
 DiseaseCardiac fibrosisICD-10 Myocarditis, unspecified (I51.4)
 DBLinkLink to databasePMID28412345
 Experimental Method
 Sample TypeCardiac Fibroblasts (CFs)ComparisonTen-week-old male diabetic db/db mice (N = 10) and control db/m mice and newborn C57BL/6 mice (1-3 days)
 Method for EstimationQuantitative PCR and MicroarraysPCR Details
 Primers
(Experimented)
Forward

CAGCGTCCTTTCTCAAGGGA

Reverse

GACCTGATTGGCCACTCAGTA

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Zhou, B, Yu, JW (2017). A novel identified circular RNA, circRNA_010567, promotes myocardial fibrosis via suppressing miR-141 by targeting TGF-β1. Biochem. Biophys. Res. Commun., 487, 4:769-775.