circRNA_100782
 Genen/aOrganismMouse
 Genome Locuschr11:33307958-33309057:+Buildn/a
 DiseasePancreatic Ductal AdenocarcinomaICD-10 Malignant neoplasm of Pancreatic duct (C25.3)
 DBLinkLink to databasePMID29255366
 Experimental Method
 Sample TypePDAC TissuesComparisonThe Pancreatic ductal adenocarcinoma (PDAC) cell lines BxPC3 and normal Pancreatic cell lines
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

TATGTTGGTGGATCCTGTTCGGCA

Reverse

TGGTGGGTAGACCAAGACTTGTGA

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Chen, G, Shi, Y, Zhang, Y, Sun, J (2017). CircRNA_100782 regulates pancreatic carcinoma proliferation through the IL6-STAT3 pathway. Onco Targets Ther, 10:5783-5794.