circRNA_101308
 Genen/aOrganismHuman
 Genome Locusn/aBuildhg19
 DiseaseGastric CancerICD-10 Stomach, Malignant neoplasm of unspecified (C16.9)
 DBLinkLink to databasePMID28206972
 Experimental Method
 Sample TypeTissuesComparison125 patients diagnosed with stage III gastric cancer tissue vs adjacent tissues
 Method for EstimationQuantitative PCR and MicroarraysPCR Details
 Primers
(Experimented)
Forward

CACCTCCATCGAACCCATCC

Reverse

CAAGCCAAATGCAATCATTAACAG

StatisticsFold Change : Upregulated,5.1072551
pvalue : p=0.019628228
 Citation
Zhang, Y, Li, J, Yu, J, Liu, H, Shen, Z, Ye, G, Mou, T, Qi, X, Li, G (2017). Circular RNAs signature predicts the early recurrence of stage III gastric cancer after radical surgery. Oncotarget, 8, 14:22936-22943.