circRNA_15703
 Genen/aOrganismHuman
 Genome Locusn/aBuildhg19
 DiseaseBreast CancerICD-10 Malignant neoplasm of breast (C50)
 DBLinkLink to databasePMID26472973
 Experimental Method
 Sample TypeMammary gland TissuesComparisonLiquid Nitrogen frozen mammary glands harvested from five rats on day 1 and 7 postpartum
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

ACAGGTTACGAAGGCAAGGAA

Reverse

ACGCTACTCTCAGTGGACAAG

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Zhang, C, Wu, H, Wang, Y, Zhao, Y, Fang, X, Chen, C, Chen, H (2015). Expression Patterns of Circular RNAs from Primary Kinase Transcripts in the Mammary Glands of Lactating Rats. J Breast Cancer, 18, 3:235-41.