circSMARCA5
 Genen/aOrganismHuman
 Genome Locusn/aBuildhg19
 DiseaseProstate cancer ICD-10 Malignant neoplasm of prostate (C61)
 DBLinkLink to databasePMID28765045
 Experimental Method
 Sample TypeTissuesComparisontumour vs normal LNCaP cell lines
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

CTCCAAGATGGGCGAAAG

Reverse

TGTGTTGCTCCATGTCTAATCA

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Kong, Z, Wan, X, Zhang, Y, Zhang, P, Zhang, Y, Zhang, X, Qi, X, Wu, H, Huang, J, Li, Y (2017). Androgen-responsive circular RNA circSMARCA5 is up-regulated and promotes cell proliferation in prostate cancer. Biochem. Biophys. Res. Commun., 493, 3:1217-1223.