circTRIM24
 GeneTRIM24OrganismHuman
 Genome Locuschr7:138203933-138255748:+Buildhg19
 DiseaseBladder CancerICD-10 Malignant neoplasm of Bladder, unspecified (C67.9)
 DBLinkLink to databasePMID27484176
 Experimental Method
 Sample TypeTissues and Cell linesComparisonFour pairs of snap-frozen bladder carcinoma tissue and matched para-carcinoma tissue
 Method for EstimationQuantitative PCR and MicroarraysPCR Details
 Primers
(Experimented)
Forward

GGATATGATGGAAAGGCTTTTG

Reverse

AAACACTGGTCGCTGGCTG

StatisticsFold Change : Downregulated,6.3227161
pvalue : p=0.0000122246
 Citation
Zhong, Z, Lv, M, Chen, J (2016). Screening differential circular RNA expression profiles reveals the regulatory role of circTCF25-miR-103a-3p/miR-107-CDK6 pathway in bladder carcinoma. Sci Rep, 6:30919.