circUBXN7
 GeneUBXN7OrganismHuman
 Genome Locuschr3:196118683-196129890:n/aBuildhg19
 DiseaseBladder CancerICD-10 Malignant neoplasm of Bladder, unspecified (C67.9)
 DBLinkLink to databasePMID30312173
 Experimental Method
 Sample TypeTissues and Cell linesComparison84 cases of BC tissues including 30 paired BC tissues and adjacent nontumor tissues and All cell lines including 293T, human immortalized uroepithelium cell SV-HUC-1 and human BC T24 and UM-UC-3 were purchased from ATCC
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

CCACCCATTGATTTGATGC

Reverse

CCGTCGTCTTTTAGGAGCAC

StatisticsFold Change : Downregulated
pvalue : p<0.05
 Citation
Liu, H, Chen, D, Bi, J, Han, J, Yang, M, Dong, W, Lin, T, Huang, J (2018). Circular RNA circUBXN7 represses cell growth and invasion by sponging miR-1247-3p to enhance B4GALT3 expression in bladder cancer. Aging (Albany NY), 10, 10:2606-2623