circVAPA
 GeneVAPAOrganismHuman
 Genome Locuschr18:9931806-9937063:+Buildhg19
 DiseaseColorectal CancerICD-10 Malignant neoplasm of rectosigmoid junction (C19)
 DBLinkLink to databasePMID30797148
 Experimental Method
 Sample TypeTissue and cell linesComparisonA total of 60 matched pairs of CRC and adjacent normal mucosatissues were collected along with peripheral blood samples
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

TGGATTCCAAATTGAGATGCGTATT

Reverse

CACTTTTCTATCCGATGGATTTCGC

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Li, XN, Wang, ZJ, Ye, CX, Zhao, BC, Huang, XX, Yang, L (2019). Circular RNA circVAPA is up-regulated and exerts oncogenic properties by sponging miR-101 in colorectal cancer. Biomed. Pharmacother., 112:108611.