circVRK1
 GeneVRK1OrganismHuman
 Genome Locuschr14:97312431-97327072:n/aBuildhg19
 DiseaseBreast CancerICD-10 Malignant neoplasm of breast (C50)
 DBLinkLink to databasePMID29221160
 Experimental Method
 Sample TypeCell LinesComparisonBreast Cancer Stem Cells (BCSCs) vs non- BCSCs
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

GAACCTGGTGTTGAAGATACGG

Reverse

AATCCTACTTTCCATTCCTTTTTTG

StatisticsFold Change : Downregulated,2.33333
pvalue : p=0.030737
 Citation
Yan, N, Xu, H, Zhang, J, Xu, L, Zhang, Y, Zhang, L, Xu, Y, Zhang, F (2017). Circular RNA profile indicates circular RNA VRK1 is negatively related with breast cancer stem cells. Oncotarget, 8, 56:95704-95718.