circad | circRNAs associated with diseases
circZMYM2
 GeneZMYM2OrganismHuman
 Genome Locuschr13:20633586-20638685:+Buildhg19
 DiseasePancreatic cancerICD-10 Malignant neoplasm of Pancreas, unspecified (C25.9)
 DBLinkLink to databasePMID30537731
 Experimental Method
 Sample TypeTissue and cell linesComparisonPC and their counterpart adjacent tissue samples were obtained from 106 patients
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

TTACCACCTGTTTTTGGCGA

Reverse

CTGGGATATACACAGGCACAGG

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
An, Y, Cai, H, Zhang, Y, Liu, S, Duan, Y, Sun, D, Chen, X, He, X (2018). circZMYM2 Competed Endogenously with miR-335-5p to Regulate JMJD2C in Pancreatic Cancer. Cell. Physiol. Biochem., 51, 5:2224-2236.