circ_0002138
 Genen/aOrganismHuman
 Genome Locusn/aBuildhg19
 DiseaseColorectal CancerICD-10 Malignant neoplasm of rectosigmoid junction (C19)
 DBLinkLink to databasePMIDhttps://www.sciencedirect.com/science/article/pii/S0753332218380016
 Experimental Method
 Sample TypeTissue and cell linesComparison35 paired CRC tissues
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

AGACACTCTGTGCTTTATGGC

Reverse

CCATTCACATACCTTCCACA

StatisticsFold Change : Downregulated
pvalue : p<0.05
 Citation
Ruan, H, Deng, X, Dong, L, Yang, D, Xu, Y, Peng, H, Guan, M (2019). Circular RNA circ_0002138 is down-regulated and suppresses cell proliferation in colorectal cancer. Biomed. Pharmacother., 111:1022-1028.