hsa_circRNA_000167/hsa_circ_0000518
 GeneRPPH1OrganismHuman
 Genome Locuschr14:20811404:20811554:-Buildhg19
 DiseaseEsophageal cancerICD-10 Oesophagus, unspecified (C15.9)
 DBLinkLink to databasePMID27465405
 Experimental Method
 Sample TypeKYSE-150 Cell linesComparison3 samples from human Esophageal Squamous Cancer cell lines KYSE-150 and radioresistant KYSE-150R cell lines
 Method for EstimationQuantitative PCR and MicroarraysPCR Details
 Primers
(Experimented)
Forward

TCTCCCTGTACGTTCTTATCTGC

Reverse

CTGCTCCCTTTGCTGGACATC

StatisticsFold Change : Downregulated,2.47
pvalue : p<0.05
 Citation
Su, H, Lin, F, Deng, X, Shen, L, Fang, Y, Fei, Z, Zhao, L, Zhang, X, Pan, H, Xie, D, Jin, X, Xie, C (2016). Profiling and bioinformatics analyses reveal differential circular RNA expression in radioresistant esophageal cancer cells. J Transl Med, 14, 1:225.