hsa_circRNA_000792
 GeneCD44OrganismHuman
 Genome Locuschr11:35163017:35163328:+Buildhg19
 DiseaseGastric CancerICD-10 Stomach, Malignant neoplasm of unspecified (C16.9)
 DBLinkLink to databasePMID28184940
 Experimental Method
 Sample TypeTissuesComparison8 Gastric Cancer (GC) tissues and adjacent tissue samples
 Method for EstimationQuantitative PCR and MicroarraysPCR Details
 Primers
(Experimented)
Forward

AGGAAGTACAATGAAGTGCCAGT

Reverse

AGAATGCCCAAAGACAAAGC

StatisticsFold Change : Upregulated,3.63
pvalue : p=0.046
 Citation
Sui, W, Shi, Z, Xue, W, Ou, M, Zhu, Y, Chen, J, Lin, H, Liu, F, Dai, Y (2017). Circular RNA and gene expression profiles in gastric cancer based on microarray chip technology. Oncol. Rep., 37, 3:1804-1814.
hsa_circRNA_000792
 GeneCD44OrganismHuman
 Genome Locusn/aBuildhg19
 DiseaseGastric CancerICD-10 Stomach, Malignant neoplasm of unspecified (C16.9)
 DBLinkLink to databasePMID28184940
 Experimental Method
 Sample TypeTissuesComparison8 Gastric Cancer (GC) tissues and adjacent tissue samples
 Method for EstimationQuantitative PCR and MicroarraysPCR Details
 Primers
(Experimented)
Forward

AGGAAGTACAATGAAGTGCCAGT

Reverse

AGAATGCCCAAAGACAAAGC

StatisticsFold Change : Upregulated,3.63
pvalue : p=0.046
 Citation
Sui, W, Shi, Z, Xue, W, Ou, M, Zhu, Y, Chen, J, Lin, H, Liu, F, Dai, Y (2017). Circular RNA and gene expression profiles in gastric cancer based on microarray chip technology. Oncol. Rep., 37, 3:1804-1814.