hsa_circRNA_001066
 GeneARIH1OrganismHuman
 Genome Locuschr15:72789131:72848248:+Buildhg19
 DiseaseGastric CancerICD-10 Stomach, Malignant neoplasm of unspecified (C16.9)
 DBLinkLink to databasePMID28184940
 Experimental Method
 Sample TypeTissuesComparison8 Gastric Cancer (GC) tissues and adjacent tissue samples
 Method for EstimationQuantitative PCR and MicroarraysPCR Details
 Primers
(Experimented)
Forward

CTTTTTCAGACTATTTCGTGTCC

Reverse

CTTCTGGAAGTACCCAATATGC

StatisticsFold Change : Downregulated,4.04
pvalue : p=0.002
 Citation
Sui, W, Shi, Z, Xue, W, Ou, M, Zhu, Y, Chen, J, Lin, H, Liu, F, Dai, Y (2017). Circular RNA and gene expression profiles in gastric cancer based on microarray chip technology. Oncol. Rep., 37, 3:1804-1814.