hsa_circRNA_100338/circSNX27
 Genen/aOrganismHuman
 Genome Locusn/aBuildhg19
 DiseaseLiver cancerICD-10 Malignant neoplasm of Liver, unspecified (C22.9)
 DBLinkLink to databasePMID28710406
 Experimental Method
 Sample TypeTissuesComparisonsnap-frozen Hepatocellular Carcinoma tissue and matched para-carcinoma tissue
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

AAAAGCAAGCAGTGCCCATA

Reverse

GCTCGAATCAGGTCCACCA

StatisticsFold Change : Upregulated,11.5
pvalue : p=0.037423
 Citation
Huang, XY, Huang, ZL, Xu, YH, Zheng, Q, Chen, Z, Song, W, Zhou, J, Tang, ZY, Huang, XY (2017). Comprehensive circular RNA profiling reveals the regulatory role of the circRNA-100338/miR-141-3p pathway in hepatitis B-related hepatocellular carcinoma. Sci Rep, 7, 1:5428.