hsa_circRNA_100855/hsa_circ_0023028
 GeneC11orf80OrganismHuman
 Genome Locuschr11:66515849-66590145:+Buildhg19
 DiseaseLaryngeal Squamous Cell CancerICD-10 Malignant neoplasm of larynx (C32)
 DBLinkLink to databasePMID27158380
 Experimental Method
 Sample TypeTissuesComparisonLaryngeal Squamous Cell Cancer (LSCC) tissues and adjacent non-tumor tissues
 Method for EstimationQuantitative PCR and MicroarraysPCR Details
 Primers
(Experimented)
Forward

GCCAAGGCTCAGCAGAAACTA

Reverse

TGTTGCTCCAAGACCTTGTCC

StatisticsFold Change : Upregulated,110.07
pvalue : p<0.001
 Citation
Xuan, L, Qu, L, Zhou, H, Wang, P, Yu, H, Wu, T, Wang, X, Li, Q, Tian, L, Liu, M, Sun, Y (2016). Circular RNA: a novel biomarker for progressive laryngeal cancer. Am J Transl Res, 8, 2:932-9.