circad | circRNAs associated with diseases
hsa_circRNA_101717
 GeneABCC1OrganismHuman
 Genome Locusn/aBuildhg19
 DiseasePancreatic cancerICD-10 Malignant neoplasm of Pancreas, unspecified (C25.9)
 DBLinkLink to databasePMID29620241
 Experimental Method
 Sample TypeTissuesComparison20 pancreatic cancer tissues and corresponding paracancerous tissues
 Method for EstimationMicroarraysPCR Details
 Primers
(Experimented)
Forward

GTCCTGTTTCTCAGATCGCTCAC

Reverse

GAAGTCGGGGTTGCTGGTATT

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Guo, S, Xu, X, Ouyang, Y, Wang, Y, Yang, J, Yin, L, Ge, J, Wang, H (2018). Microarray expression profile analysis of circular RNAs in pancreatic cancer. Mol Med Rep, 17, 6:7661-7671.