hsa_circRNA_102958
 Genen/aOrganismHuman
 Genome Locusn/aBuildhg19
 DiseaseGastric CancerICD-10 Stomach, Malignant neoplasm of unspecified (C16.9)
 DBLinkLink to databasePMID30689557
 Experimental Method
 Sample TypeTissuesComparison3 gastric cancer tissues and their matched non-gastric cancer (non-GC) tissues were collected
 Method for EstimationQuantitative PCR and MicroarraysPCR Details
 Primers
(Experimented)
Forward

GGATGCCCGCCAGAGTCCAGAT

Reverse

ACGGGCTCCTTGGTGGGGTTA

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Wei, J, Wei, W, Xu, H, Wang, Z, Gao, W, Wang, T, Zheng, Q, Shu, Y, De, W (2019). Circular RNA hsa_circRNA_102958 may serve as a diagnostic marker for gastric cancer. Cancer Biomark,