hsa_circRNA_103809
 Genen/aOrganismHuman
 Genome Locusn/aBuildhg19
 DiseaseColorectal CancerICD-10 Malignant neoplasm of rectosigmoid junction (C19)
 DBLinkLink to databasePMID30249393
 Experimental Method
 Sample TypeTissues and Cell linesComparison30 CRC tissues and matched non-tumor normal tissue specimens and Human CRC cell lines
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

ACGCATTCTTCGAGACCTCT

Reverse

TGCCTGTAACTCCTCTTCAGT

StatisticsFold Change : Downregulated
pvalue : p<0.05
 Citation
Bian, L., Zhi, X., Ma, L., Zhang, J., Chen, P., Sun, S., … Qin, J. (2018). Hsa_circRNA_103809 regulated the cell proliferation and migration in colorectal cancer via miR-532–3p / FOXO4 axis. Biochemical and Biophysical Research Communications.doi:10.1016/j.bbrc.2018.09.073