hsa_circRNA_104700
 Genen/aOrganismHuman
 Genome Locusn/aBuildhg19
 DiseaseColorectal CancerICD-10 Malignant neoplasm of rectosigmoid junction (C19)
 DBLinkLink to databasePMID28349836
 Experimental Method
 Sample TypeTissuesComparisonpaired tumor and adjacent non-tumorous tissues from six colorectal cancer patients
 Method for EstimationQuantitative PCR and MicroarraysPCR Details
 Primers
(Experimented)
Forward

TCCGACAGCAACAGGAAATG

Reverse

TGGACCTCGGACTGG GATAA

StatisticsFold Change : Downregulated,4.17
pvalue : p<‚ÄČ0.0001
 Citation
Zhang, P, Zuo, Z, Shang, W, Wu, A, Bi, R, Wu, J, Li, S, Sun, X, Jiang, L (2017). Identification of differentially expressed circular RNAs in human colorectal cancer. Tumour Biol., 39, 3:1010428317694546.