hsa_circRNA_400071
 Genen/aOrganismHuman
 Genome Locusn/aBuildhg19
 DiseaseGastric CancerICD-10 Stomach, Malignant neoplasm of unspecified (C16.9)
 DBLinkLink to databasePMID28184940
 Experimental Method
 Sample TypeTissuesComparison8 Gastric Cancer (GC) tissues and adjacent tissue samples
 Method for EstimationQuantitative PCR and MicroarraysPCR Details
 Primers
(Experimented)
Forward

CCCAAGGGTTTGGTGGGAT

Reverse

AGAGCCCAGAGTGGGAGAAGTC

StatisticsFold Change : Upregulated,3.77
pvalue : p=0.007
 Citation
Sui, W, Shi, Z, Xue, W, Ou, M, Zhu, Y, Chen, J, Lin, H, Liu, F, Dai, Y (2017). Circular RNA and gene expression profiles in gastric cancer based on microarray chip technology. Oncol. Rep., 37, 3:1804-1814.