hsa_circ_0000064
 GeneB4GALT2OrganismHuman
 Genome Locuschr1:44446997-44447136:-Buildhg19
 DiseaseLung CancerICD-10 Malignant neoplasm of bronchus and lung (C34)
 DBLinkLink to databasePMID29223555
 Experimental Method
 Sample TypeTissues and A549,H1299 Cell linesComparisonTissue samples of lung cancer and paired normal tissues
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

AGCAGGCTGACAGTGGAGTT

Reverse

CAGCACATGCAGGAACAAAA

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Luo, YH, Zhu, XZ, Huang, KW, Zhang, Q, Fan, YX, Yan, PW, Wen, J (2017). Emerging roles of circular RNA hsa_circ_0000064 in the proliferation and metastasis of lung cancer. Biomed. Pharmacother., 96:892-898.