hsa_circ_0000069
 GeneSTILOrganismHuman
 Genome Locuschr1:47745912-47748131:-Buildhg19
 DiseaseColorectal CancerICD-10 Malignant neoplasm of rectosigmoid junction (C19)
 DBLinkLink to databasePMID28003761
 Experimental Method
 Sample TypeTissues and Cell linesComparison30 paired Colorectal Cancer (CRC) tissues and adjacent noncancerous tissues
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

CTACTTCAGGCACAGGTCTTC

Reverse

CTGACTCACTGGATGAGGACT

StatisticsFold Change : Upregulated
pvalue : p<0.01
 Citation
Guo, JN, Li, J, Zhu, CL, Feng, WT, Shao, JX, Wan, L, Huang, MD, He, JD (2016). Comprehensive profile of differentially expressed circular RNAs reveals that hsa_circ_0000069 is upregulated and promotes cell proliferation, migration, and invasion in colorectal cancer. Onco Targets Ther, 9:7451-7458.