hsa_circ_0000096
 GeneHIAT1OrganismHuman
 Genome Locuschr1:100515464-100535241:+Buildhg19
 DiseaseGastric CancerICD-10 Stomach, Malignant neoplasm of unspecified (C16.9)
 DBLinkLink to databasePMID28081541
 Experimental Method
 Sample TypeTissuesComparison101 paired gastric cancer tissues and adjacent non-tumorous tissues
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

CAGTCCTTGGCATTCTTTCC

Reverse

GTGGGTGCTGTCAATAGTCC

StatisticsFold Change : Downregulated
pvalue : p<0.001
 Citation
Li, P, Chen, H, Chen, S, Mo, X, Li, T, Xiao, B, Yu, R, Guo, J (2017). Circular RNA 0000096 affects cell growth and migration in gastric cancer. Br. J. Cancer, 116, 5:626-633.