hsa_circ_0000181
 GeneTATDN3OrganismHuman
 Genome Locuschr1:212977661-212981190:+Buildhg19
 DiseaseGastric CancerICD-10 Stomach, Malignant neoplasm of unspecified (C16.9)
 DBLinkLink to databasePMID28940688
 Experimental Method
 Sample TypeTissuesComparison115 fresh gastric cancer tissues and paired adjacent nontumorous tissues
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

GAACTGAATGGGCTTGCTATGAAA

Reverse

CAGCTGCACTGAGAACATCTCTGA

StatisticsFold Change : Downregulated
pvalue : p<0.05
 Citation
Zhao, Q, Chen, S, Li, T, Xiao, B, Zhang, X (2018). Clinical values of circular RNA 0000181 in the screening of gastric cancer. J. Clin. Lab. Anal., 32, 4:e22333.