hsa_circ_0000190
 GeneCNIH4OrganismHuman
 Genome Locuschr1:224553580-224559125:+Buildhg19
 DiseaseGastric CancerICD-10 Stomach, Malignant neoplasm of unspecified (C16.9)
 DBLinkLink to databasePMID28130019
 Experimental Method
 Sample TypeTissuesComparisontumor tissue samples and their paired paracancerous histological normal tissues
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

TTGCTCCTTGGGCGCTATAC

Reverse

AGAGTCCAG CGGCAAAACTA-

StatisticsFold Change : Downregulated
pvalue : p=0.001
 Citation
Chen, S, Li, T, Zhao, Q, Xiao, B, Guo, J (2017). Using circular RNA hsa_circ_0000190 as a new biomarker in the diagnosis of gastric cancer. Clin. Chim. Acta, 466:167-171.