hsa_circ_0000504
 GeneTUBGCP3OrganismHuman
 Genome Locuschr13:113170753-113181798:-Buildhg19
 DiseaseColorectal CancerICD-10 Malignant neoplasm of rectosigmoid junction (C19)
 DBLinkLink to databasePMID28656150
 Experimental Method
 Sample TypeHCT116 Cell lineComparisonHCT116 cell lines and Chemoradiation Resistant HCT116 cells
 Method for EstimationQuantitative PCR and MicroarraysPCR Details
 Primers
(Experimented)
Forward

GCAAAGCTCCTGAGAAACAT

Reverse

AAAAGGACCTTCCTAGACTGAT

StatisticsFold Change : Upregulated,74.4
pvalue : p=6.96E − 04
 Citation
Xiong, W, Ai, YQ, Li, YF, Ye, Q, Chen, ZT, Qin, JY, Liu, QY, Wang, H, Ju, YH, Li, WH, Li, YF (2017). Microarray Analysis of Circular RNA Expression Profile Associated with 5-Fluorouracil-Based Chemoradiation Resistance in Colorectal Cancer Cells. Biomed Res Int, 2017:8421614.