hsa_circ_0000523
 GeneMETTL3OrganismHuman
 Genome Locuschr14:21971315-21972024:-Buildhg19
 DiseaseColorectal CancerICD-10 Malignant neoplasm of rectosigmoid junction (C19)
 DBLinkLink to databasePMID30403259
 Experimental Method
 Sample TypeCell linesComparisonn/a
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

CAGCATCGGAACCAGCAAAG

Reverse

CTGGGCTGTCACTACGGAAG

StatisticsFold Change : Downregulated
pvalue : p<0.05
 Citation
Jin, Y., Yu, L. L., Zhang, B., Liu, C. F., & Chen, Y. (2018). Circular RNA hsa_circ_0000523 regulates the proliferation and apoptosis of colorectal cancer cells as miRNA sponge. Brazilian Journal of Medical and Biological Research, 51(12).doi:10.1590/1414-431x20187811