hsa_circ_0000567
 GeneSETD3OrganismHuman
 Genome Locuschr14:99924615-99932150:-Buildhg19
 DiseaseColorectal CancerICD-10 Malignant neoplasm of rectosigmoid junction (C19)
 DBLinkLink to databasePMID29333615
 Experimental Method
 Sample TypeTissues and Cell linesComparison102 paired CRC tissues and adjacent noncancerous tissues, 5 CRC cell lines, and a normal colorectal epithelial cell line
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

AGTTCGGTATCTTCAGTCCACAC

Reverse

TCTTACCCATTTTTCTGACTGGATG

StatisticsFold Change : Downregulated
pvalue : p<0.05
 Citation
Wang, J, Li, X, Lu, L, He, L, Hu, H, Xu, Z (2018). Circular RNA hsa_circ_0000567 can be used as a promising diagnostic biomarker for human colorectal cancer. J. Clin. Lab. Anal., 32, 5:e22379.