circad | circRNAs associated with diseases
hsa_circ_0000677/hsa_circ_001569/circABCC
 GeneABCC1OrganismHuman
 Genome Locuschr16:16101672-16162159:+Buildhg19
 DiseaseColorectal CancerICD-10 Malignant neoplasm of rectosigmoid junction (C19)
 DBLinkLink to databasePMID27058418
 Experimental Method
 Sample TypeTissuesComparisontissue samples and matched non-tumor normal tissue samples
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

TCCCCTGAACATTCTCCCCAT

Reverse

GAAAGCACTTGGTGAAGTCGG

StatisticsFold Change : Upregulated
pvalue : p=0.003
 Citation
Xie, H, Ren, X, Xin, S, Lan, X, Lu, G, Lin, Y, Yang, S, Zeng, Z, Liao, W, Ding, YQ, Liang, L (2016). Emerging roles of circRNA_001569 targeting miR-145 in the proliferation and invasion of colorectal cancer. Oncotarget, 7, 18:26680-91.