hsa_circ_0000993
 Genen/aOrganismHuman
 Genome Locuschr2:38545676-38546161:-Buildhg19
 DiseaseGastric CancerICD-10 Stomach, Malignant neoplasm of unspecified (C16.9)
 DBLinkLink to databasePMID30215537
 Experimental Method
 Sample TypeCell LinesComparisonHuman gastric cancer cell lines SGC-7901 and BGC-823 were purchased from the Cell Bank of the Chinese Academy of Sciences
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

GTTGCTGTGCTGCTTATGGA

Reverse

CTCGCCATGTAAAGCCTGTC

StatisticsFold Change : Downregulated
pvalue : p<0.05
 Citation
Zhong, S., Wang, J., Hou, J., Zhang, Q., Xu, H., Hu, J., … Feng, J. (2018). Circular RNA hsa_circ_0000993 inhibits metastasis of gastric cancer cells. Epigenomics. doi:10.2217/epi-2017-0173