hsa_circ_0001313
 Genen/aOrganismHuman
 Genome Locusn/aBuildhg19
 DiseaseColon CancerICD-10 Malignant neoplasm of Colon, unspecified (C18.9)
 DBLinkLink to databasePMID30630646
 Experimental Method
 Sample TypeTissue and cell linesComparisonRadio-sensitive colon cancer tissue samples (n = 42) were collected
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

GTATCTTGCCAGCTTTCTCCG

Reverse

TGCAGTTCTTGTTTCACAGC

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Wang, L, Peng, X, Lu, X, Wei, Q, Chen, M, Liu, L (2018). Inhibition of hsa_circ_0001313 (circCCDC66) induction enhances the radio-sensitivity of colon cancer cells via tumor suppressor miR-338-3p: Effects of cicr_0001313 on colon cancer radio-sensitivity. Pathol. Res. Pract.,