hsa_circ_0001313/circCCDC66
 GeneCCDC66OrganismHuman
 Genome Locuschr3:56626997-56628056:+Buildhg19
 DiseaseColorectal CancerICD-10 Malignant neoplasm of rectosigmoid junction (C19)
 DBLinkLink to databasePMID28249903
 Experimental Method
 Sample TypeTissuesComparison12 paired tumor/adjacent non-tumor specimens
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

TCTCTTGGACCCAGCTCAG

Reverse

TGAATCAAAGTGCATTGCCC

StatisticsFold Change : Upregulated,> 1.5
pvalue : p<0.05
 Citation
Hsiao, KY, Lin, YC, Gupta, SK, Chang, N, Yen, L, Sun, HS, Tsai, SJ (2017). Noncoding Effects of Circular RNA CCDC66 Promote Colon Cancer Growth and Metastasis. Cancer Res., 77, 9:2339-2350.