hsa_circ_0001895/circPRRC2B/hsa_circ_000760
 GenePRRC2BOrganismHuman
 Genome Locuschr9:134305476-134308181:+Buildhg19
 DiseaseGastric CancerICD-10 Stomach, Malignant neoplasm of unspecified (C16.9)
 DBLinkLink to databasePMID28443463
 Experimental Method
 Sample TypeTissuesComparison96 gastric cancer tissues and their adjacent non-tumorous tissues
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

GCAAACAAGCAGGATCAGCAA

Reverse

CCCATCCTTGCCCTTGGTAA

StatisticsFold Change : Downregulated
pvalue : p<0.001
 Citation
Shao, Y, Chen, L, Lu, R, Zhang, X, Xiao, B, Ye, G, Guo, J (2017). Decreased expression of hsa_circ_0001895 in human gastric cancer and its clinical significances. Tumour Biol., 39, 4:1010428317699125.