hsa_circ_0001982
 GeneRNF111OrganismHuman
 Genome Locuschr15:59323002-59323901:+Buildhg19
 DiseaseBreast CancerICD-10 Malignant neoplasm of breast (C50)
 DBLinkLink to databasePMID28933584
 Experimental Method
 Sample TypeTissuesComparison29 breast cancer tissues and adjacent normal tissues
 Method for EstimationQuantitative PCR and MicroarraysPCR Details
 Primers
(Experimented)
Forward

TAGCAGTTCCCCAATCCTTG

Reverse

CACAAATTCCCATCATTCCC

StatisticsFold Change : Upregulated,7.74
pvalue : p<0.05
 Citation
Tang, YY, Zhao, P, Zou, TN, Duan, JJ, Zhi, R, Yang, SY, Yang, DC, Wang, XL (2017). Circular RNA hsa_circ_0001982 Promotes Breast Cancer Cell Carcinogenesis Through Decreasing miR-143. DNA Cell Biol., 36, 11:901-908.