hsa_circ_0006633
 GeneFGGYOrganismHuman
 Genome Locuschr1:59805629-59844509:+Buildhg19
 DiseaseGastric CancerICD-10 Stomach, Malignant neoplasm of unspecified (C16.9)
 DBLinkLink to databasePMID28656881
 Experimental Method
 Sample TypeTissuesComparison96 gastric cancer tissues and their adjacent non-tumorous tissues
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

CTCCCGGACTTCTTATCGTGG

Reverse

CGATGGTCCAGCCACATGAT

StatisticsFold Change : Downregulated
pvalue : p<0.001
 Citation
Lu, R, Shao, Y, Ye, G, Xiao, B, Guo, J (2017). Low expression of hsa_circ_0006633 in human gastric cancer and its clinical significances. Tumour Biol., 39, 6:1010428317704175.