hsa_circ_0007385
 GeneMEMO1OrganismHuman
 Genome Locuschr2:32142994-32157204:-Buildhg19
 DiseaseNon-Small cell Lung Cancer tumorigenesisICD-10 Malignant neoplasm of bronchus and lung (C34)
 DBLinkLink to databasePMID29372377
 Experimental Method
 Sample TypeTissuesComparisonPairs of Non-Small cell Lung Cancer tumorigenesis (NSCLC) tissue and adjacent non-cancerous lung tissue was excised from patients and immediately frozen for further analysis.
 Method for EstimationQuantitative PCR and MicroarraysPCR Details
 Primers
(Experimented)
Forward

CGTGACCCAGAAGTGCGTTCACA

Reverse

TGGGGGTGTATCAGTCTTTGGTT

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Jiang, MM, Mai, ZT, Wan, SZ, Chi, YM, Zhang, X, Sun, BH, Di, QG (2018). Microarray profiles reveal that circular RNA hsa_circ_0007385 functions as an oncogene in non-small cell lung cancer tumorigenesis. J. Cancer Res. Clin. Oncol., 144, 4:667-674.