hsa_circ_0007534
 GeneDDX42OrganismHuman
 Genome Locuschr17:61869771-61877977:+Buildhg19
 DiseaseNon small cell Lung Cancer ICD-10 Malignant neoplasm of bronchus and lung (C34)
 DBLinkLink to databasePMID29364478
 Experimental Method
 Sample TypeTissues and Cell linesComparison98 pairs of NSCLC tissues and adjacent non-tumor tissue samples
 Method for EstimationQuantitative PCR and MicroarraysPCR Details
 Primers
(Experimented)
Forward

GTGACGGAAATCCAATTGCACC

Reverse

ATGGAATTGCTGGCGAGTTG

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Zhang, R, Xu, J, Zhao, J, Wang, X (2018). Silencing of hsa_circ_0007534 suppresses proliferation and induces apoptosis in colorectal cancer cells. Eur Rev Med Pharmacol Sci, 22, 1:118-126.