hsa_circ_0008305 (circPTK2)
 GenePTK2OrganismHuman
 Genome Locuschr8:141799572-141840625:-Buildhg19
 DiseaseNon small cell Lung Cancer ICD-10 Malignant neoplasm of bronchus and lung (C34)
 DBLinkLink to databasePMID30261900
 Experimental Method
 Sample TypeTissues and Cell linesComparisonSeventy-three fresh NSCLC tissues and paired adjacent noncancerous lung tissues and Human lung normal epithelial cell BEAS-2B, and NSCLC cells A549, H1299, H1650, SPC-A1, and Calu3
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

GCCAACAGCGAAAAGCAAG

Reverse

TTTGGCCTTGACAGAATCCAG

StatisticsFold Change : Downregulated
pvalue : p<0.05
 Citation
Wang L, Tong X, Zhou Z, et al. Circular RNA hsa_circ_0008305 (circPTK2) inhibits TGF-β-induced epithelial-mesenchymal transition and metastasis by controlling TIF1γ in non-small cell lung cancer. Mol Cancer. 2018;17(1):140. Published 2018 Sep 27. doi:10.1186/s12943-018-0889-7