hsa_circ_0011946
 GeneSCMH1OrganismHuman
 Genome Locuschr1:41578954-41618413:-Buildhg19
 DiseaseBreast CancerICD-10 Malignant neoplasm of breast (C50)
 DBLinkLink to databasePMID29593432
 Experimental Method
 Sample TypeTissues and U251, U118, LN229, and U87MG Cell linesComparisonThree pairs of breast cancer and corresponding adjacent non-cancerous tissues and Six breast cancer cell lines (HS-578T, T47D, MCF-7, BT549, MDA-MB-231, and SKBR-3)
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

GCTGGTGTTCCTTGACTGGA

Reverse

CACTGTAGCAAACCAGCATTTCT

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Zhou, J, Zhang, WW, Peng, F, Sun, JY, He, ZY, Wu, SG (2018). Downregulation of hsa_circ_0011946 suppresses the migration and invasion of the breast cancer cell line MCF-7 by targeting RFC3. Cancer Manag Res, 10:535-544.