hsa_circ_0016760
 GeneSNAP47OrganismHuman
 Genome Locuschr1:227935392-227947186:+Buildhg19
 DiseaseNon small cell Lung Cancer ICD-10 Malignant neoplasm of bronchus and lung (C34)
 DBLinkLink to databasePMID29440731
 Experimental Method
 Sample TypeTissuesComparison46 Non small cell Lung Cancer (NSCLC) tissues and corresponding 46 adjacent tissues
 Method for EstimationQuantitative PCR and MicroarraysPCR Details
 Primers
(Experimented)
Forward

TGCATTGGTGCTCAGAAGCG

Reverse

TCTGTTCCTGGGTCTGTGTGC

StatisticsFold Change : Upregulated,4.36
pvalue : p=0.02712
 Citation
Zhang, S, Zeng, X, Ding, T, Guo, L, Li, Y, Ou, S, Yuan, H (2018). Microarray profile of circular RNAs identifies hsa_circ_0014130 as a new circular RNA biomarker in non-small cell lung cancer. Sci Rep, 8, 1:2878.