hsa_circ_001783
 Genen/aOrganismHuman
 Genome Locuschr9: 37086664-37121124:n/aBuildhg19
 DiseaseBreast Cancer ICD-10 Malignant neoplasm of breast (C50)
 DBLinkLink to databasePMID30670688
 Experimental Method
 Sample TypeTissuesComparisonparaffin-embedded tissue samples and paired non-tumorigenesis tissue samples (n = 18) were collected
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

CGGGAGCTGTGACCCTTTC

Reverse

AAAGACTGCTGCCCAGTGAAT

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Liu, Z, Zhou, Y, Liang, G, Ling, Y, Tan, W, Tan, L, Andrews, R, Zhong, W, Zhang, X, Song, E, Gong, C (2019). Circular RNA hsa_circ_001783 regulates breast cancer progression via sponging miR-200c-3p. Cell Death Dis, 10, 2:55.