hsa_circ_0018289
 GeneSYT15OrganismHuman
 Genome Locuschr10:46968580-46969453:-Buildhg19
 DiseaseCervical CancerICD-10 Malignant neoplasm of cervix uteri (C53)
 DBLinkLink to databasePMID29156822
 Experimental Method
 Sample TypeTissuesComparison35 pairs of cervical cancer tissue compared with adjacent normal tissue and cell lines
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

TCACCAACCTTTGCCCTTCACACCT

Reverse

AAGACTTACGTCTGTGTGCGTTGT

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Gao, YL, Zhang, MY, Xu, B, Han, LJ, Lan, SF, Chen, J, Dong, YJ, Cao, LL (2017). Circular RNA expression profiles reveal that hsa_circ_0018289 is up-regulated in cervical cancer and promotes the tumorigenesis. Oncotarget, 8, 49:86625-86633.