hsa_circ_001988
 GeneFBXW7OrganismHuman
 Genome Locuschr4:153332454-153333681:-Buildhg19
 DiseaseColorectal CancerICD-10 Malignant neoplasm of rectosigmoid junction (C19)
 DBLinkLink to databasePMID26884878
 Experimental Method
 Sample TypePlacental TissuesComparison40 placental tissues from Pre-Eclampsia (PE) patients and 35 placental tissues from gestational age-matched patients who gave premature birth
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

CCAGTAGTATTGTGGACCTGCCC

Reverse

CCCTCTGACCCAGTAACTCCACT

StatisticsFold Change : Downregulated
pvalue : p<0.001
 Citation
Wang, X, Zhang, Y, Huang, L, Zhang, J, Pan, F, Li, B, Yan, Y, Jia, B, Liu, H, Li, S, Zheng, W (2015). Decreased expression of hsa_circ_001988 in colorectal cancer and its clinical significances. Int J Clin Exp Pathol, 8, 12:16020-5.