hsa_circ_0020397
 GeneDOCK1OrganismHuman
 Genome Locuschr10:128768965-128926028:+Buildhg19
 DiseaseColorectal CancerICD-10 Malignant neoplasm of rectosigmoid junction (C19)
 DBLinkLink to databasePMID28707774
 Experimental Method
 Sample TypeCell LinesComparisonhuman colonic epithelial cells (CCD 841 CoN) and colorectal cell lines (LoVo, HCT116, SW480 and SW620)
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

GACCGTGAACCGAACCGTCATTTC

Reverse

TCATCCGCTCCTC TGGCATCATAG

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Zhang, XL, Xu, LL, Wang, F (2017). Hsa_circ_0020397 regulates colorectal cancer cell viability, apoptosis and invasion by promoting the expression of the miR-138 targets TERT and PD-L1. Cell Biol. Int., 41, 9:1056-1064.