hsa_circ_0023404/circRNA_100876/circ-CER
 GeneRNF121OrganismHuman
 Genome Locuschr11:71668272-71671937:+Buildhg19
 DiseaseNon small cell Lung Cancer ICD-10 Malignant neoplasm of bronchus and lung (C34)
 DBLinkLink to databasePMID28343871
 Experimental Method
 Sample TypeTissuesComparison101 paired NSCLC and adjacent non-tumor tissue specimens
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

CTGGTGCAGTGGAAGCAGAG

Reverse

CGACCCTCCATTGCTCTTCT

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Yao, JT, Zhao, SH, Liu, QP, Lv, MQ, Zhou, DX, Liao, ZJ, Nan, KJ (2017). Over-expression of CircRNA_100876 in non-small cell lung cancer and its prognostic value. Pathol. Res. Pract., 213, 5:453-456.