hsa_circ_0041732
 Genen/aOrganismHuman
 Genome Locusn/aBuildhg19
 DiseaseGastric CancerICD-10 Stomach, Malignant neoplasm of unspecified (C16.9)
 DBLinkLink to databasePMID28737829
 Experimental Method
 Sample TypeTissuesComparisonThree sets of primary Gastric Cancer (GC) tissue samples (the GC group) and paired, adjacent noncancerous tissues
 Method for EstimationQuantitative PCR and MicroarraysPCR Details
 Primers
(Experimented)
Forward

GCTCACATGCCCACCCATTA

Reverse

CAGCCACTTGGTGCCACTTT

StatisticsFold Change : Downregulated,7.16
pvalue : p=0.024
 Citation
Huang, YS, Jie, N, Zou, KJ, Weng, Y (2017). Expression profile of circular RNAs in human gastric cancer tissues. Mol Med Rep, 16, 3:2469-2476.