hsa_circ_0052112
 GeneZNF83OrganismHuman
 Genome Locuschr19:53158813-53164096:-Buildhg19
 DiseaseBreast Cancer ICD-10 Malignant neoplasm of breast (C50)
 DBLinkLink to databasePMID30257349
 Experimental Method
 Sample TypeCell LinesComparisonHuman breast cancer cell line MCF-7 and MDA-MB-231 were purchased from the Cell Bank of the Chinese Academy of Sciences
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

AGAGGGCTTTATACAGGGCC

Reverse

CCCTGAAAGTCAAGCATCCC

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Zhang, H., Jiang, L., Hou, J., Zhong, S., Zhou, S., Zhu, L., … Tang, J. (2018). Circular RNA hsa_circ_0052112 promotes cell migration and invasion by acting as sponge for miR-125a-5p in breast cancer. Biomedicine & Pharmacotherapy, 107, 1342–1353.doi:10.1016/j.biopha.2018.08.030