hsa_circ_0071589
 GeneFAT1OrganismHuman
 Genome Locuschr4:187517693-187518946:-Buildhg19
 DiseaseColorectal CancerICD-10 Malignant neoplasm of rectosigmoid junction (C19)
 DBLinkLink to databasePMID29710537
 Experimental Method
 Sample TypeTissuesComparisoncomparison of Colorectal Cancer tissues with normal tissues
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

CAAACTCCCCTTCTGACAGC

Reverse

CCGAATCACACTGACAAACG

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Yong, W, Zhuoqi, X, Baocheng, W, Dongsheng, Z, Chuan, Z, Yueming, S (2018). Hsa_circ_0071589 promotes carcinogenesis via the miR-600/EZH2 axis in colorectal cancer. Biomed. Pharmacother., 102:1188-1194.