hsa_circ_0072995
 GeneRGNEFOrganismHuman
 Genome Locuschr5:73069679-73076570:+Buildhg19
 DiseaseBreast Cancer ICD-10 Malignant neoplasm of breast (C50)
 DBLinkLink to databasePMID30182731
 Experimental Method
 Sample TypeCell LinesComparisonHuman breast cancer cell lines MCF-7 and MDA-MB-231
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

AGAACAGCTATGCCCTCCAG

Reverse

CCCATCTCATAGCCAGGTGT

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Zhang, H., Jiang, L., Hou, J., Zhou, S., Zhong, S., Zhu, L., … Ji, Z. (2018). Circular RNA hsa_circ_0072995 promotes breast cancer cell migration and invasion through sponge for miR-30c-2-3p. Epigenomics.doi:10.2217/epi-2018-0002